Alexandru Bologa
I am a PhD student who is dedicated and motivated to gain knowledge in the fields of
genetics, genomics and bioinformatics. I am passionate about science, and I love Drosophila melanogaster. :)
Activity
-
Alexandru Bologa made a comment
The course was great. It is very useful, practical and clearly written. I would like to see more about nanopore data analysis. Thank you!
-
@RuthNanjala Can't the hard clipping process introduce artificial deletions in the alignments? If in the above example the sequence ACGTGATCGTACGGTCG[NNNNNNN]TCGACGTAGCTAGC is converted to the sequence ACGTGATCGTACGGTCGTCGACGTAGCTAGC consecutive to the soft/hard clipping process, we will not see a 7 bp deletion reported compared to the reference in the variant...
-
Of course :)
-
Alexandru Bologa made a comment
Can someone explain the soft/hard clipping process ? Are those base pairs present in reads but removed/ignored in the alignments because there are no extended matches? Thank you.
-
Alexandru Bologa made a comment
Thank you for the course. It was really helpful !
-
Alexandru Bologa made a comment
Thanks ! I find the course very useful.
-
Thank you very much ! The course is great !
-
Alexandru Bologa made a comment
Hi !
What if I have a column with strings and among them, some are similar, i.e "Ideal", "Idea", "Identity". I want to extract those starting with "Ide", I've tried to use the pattern ''$2=="Ide*" but it doesn't seem to work. Thanks ! -
Alexandru Bologa made a comment
I ♥ Terminal :)
